Creature DNA Fingerprinting

CAGTCAGTAGCTAGGATCGTAGCCAGCTATCTAGCTAGCATGCTAGCTAG

GTCAGTCATCGATCCTAGCATCGGTCGATAGATCGATCGTACGATCGATC

Design a Species

1. Single Allele Trait (Skin Texture)

SS(soft) Ss (medium) ss(rough)

2. Single Allele Trait (Hair Line)

FF(full face) Ff(half) ff(no hair)

3. Codominant Trait (eye shape)

OO (O shaped) Oo(bd shaped) oo(00 shaped)

4. Multiple Allele Trait (Arms)

SA(straight arms) Sa(wrinkled arms) sa(crooked arms)

5. Sex Linked Trait (ears)

X^X^ (female ears, stars) X^X (female ears, foil) XX (female no ears)

X^Y (male ears) XY (male no ears)

6. Incomplete Dominance Trait (leg color)

RR(red) Rr(purple) rr(blue)

My Creatures Genotype: SSFfOoSAX^XRr

Homozygous dominate=Skin texture

Heterozygous dominate=Hair line

Heterozygous dominate=Eye shape

Homozygous dominate=Arm

Carrier for ears

Incomplete dominance=Leg color

Debate Sources

1. Prentice Hall, p.330

2. http://www.csa.com/discoveryguides/gmfood/overview.php

3. http://www.ornl.gov/sci/techresources/Human_Genome/elsi/gmfood.shtml

Argument Points

• When the plants cross pollinate the substance could contaminate other plants and foods.
• The pollinators who feed off of the plants will be consuming these contaminating plants.
• Insects such as mosquitoes will become resistant to the pesticides the GM plants produce on their own.
• People who are allergic to certain substances which could have been used in these GM foods don't know what they are eating if the labeling does not show all of the pesticides used in their plants.
• The businesses that have been genetically altered the seeds that farmers have to buy at higher prices because of the work that has been done to them. In turn the food that has been grown form the seeds are sold to the consumers at a higher price in order to make profit.

Debate

Pro: Genetically modified foods need stricter controls

In preparing for this debate I researched the downfalls of genetically modified foods and why they should be limited or have limits. In my argument I presented different topics that contribute to why GM foods are a downfall. GM foods are food/plants that have been genetically (DNA) altered by the addition of foreign genes to enhance a desired trait such as increased resistance to herbicides or improved nutritional content. In my debate I went through all of my points listed above. My opponent Olivia Kretschmer also had some very well stated points for her side of the debate. Some of her points that she stated were that GM foods increase the production of crops and make them bigger and healthier crops as well. I think that she was very well knowledgeable about her subject and was well prepared to defend her side of the argument. I received a score of 14 out of 16 which ironically my opponent got as well. I believe that if I would have spent more time reviewing my information I would have not been as dependent on my notes while presenting the debate.